Nikkaluokta mahdiehiae Tedersoo 2024, sp. nov. ...
Nikkaluokta mahdiehiae Tedersoo sp. nov. Diagnosis. Separation from other species of Nikkaluokta based on the ITS region (positions 97–116 cctgggcaaatttttttttc; one mismatch allowed) and LSU (positions 687–717 cttggatataagaagtggaatctacacaaat; one mismatch allowed) as indicated in Fig. 12. Type. Soil...
| Main Authors: | , , , |
|---|---|
| Format: | Text |
| Language: | unknown |
| Published: |
Zenodo
2024
|
| Subjects: | |
| Online Access: | https://dx.doi.org/10.5281/zenodo.13286546 https://zenodo.org/doi/10.5281/zenodo.13286546 |
| Summary: | Nikkaluokta mahdiehiae Tedersoo sp. nov. Diagnosis. Separation from other species of Nikkaluokta based on the ITS region (positions 97–116 cctgggcaaatttttttttc; one mismatch allowed) and LSU (positions 687–717 cttggatataagaagtggaatctacacaaat; one mismatch allowed) as indicated in Fig. 12. Type. Soil eDNA sample TUE 100497 (holotype); eDNA sequence EUK 1203196 (lectotype); subarctic Pinus sylvestris forest (soil sample TUE 000497) in Nikkaluokta, Sweden, 67.85596 ° N, 19.47575 ° E. Description. Other sequences: EUK 1203537 (type locality) and EUK 1603797 (GSMc plot G 5003, Pinus sylvestris forest soil in Naissaare, Estonia, 59.56340 ° N, 24.54510 ° E). Etymology. Nikkaluokta (Sami) refers to type locality; and Mahdieh (Persian) refers to the first name of Mahdieh Hosseyni Moghaddam who sequenced the type materials using target capture protocols. Notes. Found in Sweden and Estonia, with ITS and LSU sequences displaying up to 1 % and 0.2 % differences, respectively. ... : Published as part of Tedersoo, Leho, Magurno, Franco, Alkahtani, Saad & Mikryukov, Vladimir, 2024, Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes), pp. 249-271 in MycoKeys 107 on pages 249-271, DOI: 10.3897/mycokeys.107.125549 ... |
|---|