Lehetua indrekii Tedersoo 2024, sp. nov. ...
Lehetua indrekii Tedersoo sp. nov. Diagnosis. Separation from other species of Lehetua based on the ITS region (positions 219–248 ttataatcttacgaagtactgaggtgatta; one mismatch allowed) and LSU (positions 515–546 aactaaaggratgtggctcctcggagtgttta; one mismatch allowed) as indicated in Fig. 9. Type. Soi...
| Main Authors: | , , , |
|---|---|
| Format: | Text |
| Language: | unknown |
| Published: |
Zenodo
2024
|
| Subjects: | |
| Online Access: | https://dx.doi.org/10.5281/zenodo.13286522 https://zenodo.org/doi/10.5281/zenodo.13286522 |
| Summary: | Lehetua indrekii Tedersoo sp. nov. Diagnosis. Separation from other species of Lehetua based on the ITS region (positions 219–248 ttataatcttacgaagtactgaggtgatta; one mismatch allowed) and LSU (positions 515–546 aactaaaggratgtggctcctcggagtgttta; one mismatch allowed) as indicated in Fig. 9. Type. Soil eDNA sample TUE 103095 (holotype); type sequence EUK 1603180 (lectotype); GSMc plot S 590, Populus tremula forest (soil sample TUE 003095) in Lehetu, Estonia, 59.01857 ° N, 24.28041 ° E. Description. Other sequences: EUK 1603180 (type locality); EUK 1602367 (LSU only; type locality; also found in 50 other sites in Estonia); EUK 1634481 (GSMc plot G 4195, Quercus robur woodland soil in Lustivere, Estonia, 58.66293 ° N, 26.08465 ° E); EUK 1603818 (GSMc plot G 5824, managed grassland soil in Kuremaa, Estonia, 58.74138 ° N, 26.52727 ° E); EUK 1603131 (GSMc plot G 4105, Picea abies forest soil in Lepa, Estonia, 57.70158 ° N, 26.23993 ° E); EUK 0021956 (GSMc plot G 5150, subarctic grassland soil in Kokelv, Norway, ... : Published as part of Tedersoo, Leho, Magurno, Franco, Alkahtani, Saad & Mikryukov, Vladimir, 2024, Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes), pp. 249-271 in MycoKeys 107 on pages 249-271, DOI: 10.3897/mycokeys.107.125549 ... |
|---|