Zona pellucida (ZP3) sequence data from 230 Pacific cod (phased) ...

• Main Author: Spies, Ingrid
• Format: Dataset
• Language: English
• Published: Dryad 2021
• Subjects: FOS Agriculture, forestry, and fisheries; Pacific; atlantic cod; Gadus morhua
• Online Access: https://dx.doi.org/10.5061/dryad.wdbrv15q7; https://datadryad.org/stash/dataset/doi:10.5061/dryad.wdbrv15q7

Genetic differentiation has been observed in marine species even when no obvious barriers to gene flow exist, and understanding such differentiation is essential for effective fisheries management. Highly differentiated outlier loci can provide information on how genetic variation might contribute to local adaptation but may also be affected by historical demographic events. A locus which aligned to a predicted zona pellucida sperm-binding protein 3 gene (ZP3) in Atlantic cod (Gadus morhua) was previously identified as the highest outlier based on FST in a RADseq study of Pacific cod (Gadus macrocephalus) across the West Coast of North America. However, because of the limited length of the RAD sequence and restricted geographic area of sampling, no conclusion on the functional significance of the observed variation was possible. In other marine species, ZP3 is involved in reproductive isolation, local adaptation, and has neofunctionalized as an antifreeze gene, and so it may provide important insights in ... : PCRs for the variable region of the putative zona pellucida subunit 3 gene (primer ZP_GM, F: 3' gcaatctgagggtaggacca 5', R: 3' aacgcagtgatccacaaaga 5') were carried out in a 25 µl volume, with Phusion 5X buffer (New England Biolabs, Ipswich, MA), 10mM dNTPs, 10µM forward and reverse primers, 0.2µL Phusion Taq polymerase and approximately 200ng DNA. Thermal cycling conditions were 98°C for 30 sec, followed by 5 cycles of 98°C for 10 sec, 63-59°C touchdown for 30 seconds (-1°C each cycle for 5 cycles) and 72°C for 30 seconds, and then by 30 cycles of 98°C for 10 seconds, 58°C for 30 seconds and 72°C for 30 seconds, and concluded at 72°C for 5 minutes. A total of 230 Pacific cod were sequenced to screen 544 bp of the variable region of ZP3 using primers ZP_GM (Table 1). Sanger sequencing was performed bidirectionally using forward and reverse primers at MCLAB (320 Harbor Way, South San Francisco, CA). Contigs were aligned using Sequencher v. 5.0 (Gene Codes Corporation, Ann Arbor, MI) and scores below 80% ...