Supplemental Data Genetic Structure and Extinction of the Woolly Mammoth

Three different PCR-amplification strategies were employed to generate the 741 bp contig used in this analysis, as discussed in the Experimental Procedures. Strategy 1 climate of the Eastern-Siberian Arctic, derived from fossil plants, insects and animals. Quat. Sci. Rev. 24, 533–569. S7. Guthrie, R...

Full description

Bibliographic Details
Main Authors: Mammuthus Primigenius, Tatiana Kuznetsova, Andrei Sher, Dale Guthrie, Mark G. Thomas
Other Authors: The Pennsylvania State University CiteSeerX Archives
Format: Text
Language:English
Subjects:
Arctic
Bering Sea
Online Access:http://citeseerx.ist.psu.edu/viewdoc/summary?doi=10.1.1.330.9453
http://download.cell.com/current-biology/mmcs/journals/0960-9822/piis0960982207014145.mmc1.pdf
Description
Summary:Three different PCR-amplification strategies were employed to generate the 741 bp contig used in this analysis, as discussed in the Experimental Procedures. Strategy 1 climate of the Eastern-Siberian Arctic, derived from fossil plants, insects and animals. Quat. Sci. Rev. 24, 533–569. S7. Guthrie, R.D. (2004). Radiocarbon evidence of mid-Holocene mammoths stranded on an Alaskan Bering Sea island. Nature 249, 746–749. mam_15038F GGCGTCCTAGCCCTACTCCTATCAAT mam_15399R TTGTTTGCAGGGAATAGTTTAAGAAG mam_15178F TGAATTGGCAGCCAACCAGTAGAA mam_15530R TATAAGCATGGGGTAAATAATGTGATG mam_15393F CCTCGCTATCAATACCCAAAACTG mam_15780R CGAGAAGAGGGACACGAAGATG

Similar Items