Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples

Progress Code: completed Purpose To detect krill species in the Southern Ocean from environmental DNA samples. This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon siz...

Full description

Bibliographic Details
Other Authors: AADC (owner), AADC, DATA OFFICER (distributor), AADC, DATA OFFICER (custodian), AU/AADC > Australian Antarctic Data Centre, Australia (hasAssociationWith), Australian Antarctic Data Centre (publisher), Australian Antarctic Division (sponsor), DEAGLE, BRUCE (hasPrincipalInvestigator), KING, ROB (hasPrincipalInvestigator), MACDONALD, ANNA (hasPrincipalInvestigator), NESTER, GEORGIA (hasPrincipalInvestigator), POLANOWSKI, ANDREA (hasPrincipalInvestigator), RAYMOND, BEN (collaborator), RAYMOND, BEN (hasPrincipalInvestigator), SUTER, LEONIE (collaborator), SUTER, LEONIE (hasPrincipalInvestigator), SUTER, LEONIE (author), WOTHERSPOON, SIMON (collaborator), WOTHERSPOON, SIMON (hasPrincipalInvestigator)
Format: Dataset
Language:unknown
Published: Australian Ocean Data Network
Subjects:
AMD
Online Access:https://researchdata.edu.au/raw-sequencing-euphausiid-dna-samples/2823240
Description
Summary:Progress Code: completed Purpose To detect krill species in the Southern Ocean from environmental DNA samples. This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon size ~209 bp including primers). Samples were collected in 2019 on a resupply voyage between Davis station (Antarctica) and Hobart (Tasmania). Further information on the samples, the data and the species detected can be found in the associated publication (Suter et al. (2023) Environmental DNA of Antarctic krill (Euphausia superba): measuring DNA fragmentation adds a temporal aspect to quantitative surveys. Environmental DNA).