Eurythenes sigmiferus D'Acoz & Havermans, 2015, sp. nov.
Eurythenes sigmiferus sp. nov. (Figs 47 –52) Eurythenes gryllus.— ? Barnard, 1961: 35, in part, fig. 5.—? Bowman & Manning, 1972: 193, figs. 2–5, in part (Guadeloupe and Andros material only).— Escobar-Briones et al ., 2010: 177, in part. Eurythenes gryllus clade Eg6.— Havermans et al. , 2013: 1...
| Main Authors: | , |
|---|---|
| Format: | Other/Unknown Material |
| Language: | unknown |
| Published: |
Zenodo
2015
|
| Subjects: | |
| Online Access: | https://doi.org/10.5281/zenodo.5470192 http://treatment.plazi.org/id/852B87B0FFE7FFEA6CE3FF1BFBD42033 |
| Summary: | Eurythenes sigmiferus sp. nov. (Figs 47 –52) Eurythenes gryllus.— ? Barnard, 1961: 35, in part, fig. 5.—? Bowman & Manning, 1972: 193, figs. 2–5, in part (Guadeloupe and Andros material only).— Escobar-Briones et al ., 2010: 177, in part. Eurythenes gryllus clade Eg6.— Havermans et al. , 2013: 12 –13, fig. 5 (1A). Material examined. HOLOTYPE. RV Meteor, expedition DIVA 3, ME 79-1, sta. 542, 26°33'21"S 035°11'29"W, 4480 m, baited trap, 21.vii.2009: 1 specimen, 53 mm, fixed first 96% denatured ethanol, coll. Ed Hendrycks, DZMB-HH 7991, ZMH K 44286; BraB-8, EG-2101108, JX887070 (16S). Voucher DNA sequences. HOLOTYPE, BraB-8, EG-2101108. 16S (GenBANK JX887070): TGCTATAAGGGTAGTGTATGGTAAGGCCTGCCCAGTGATTAATTAAACGGCTGCGGTATATTGACCGTG CTAAGGTAGCATAGTCATTTGTCTTTTAATTGGGGGCTGGAATGAAGGGTTTAACAAAAGATAGTGTCT TTATTTTAAATTTGTAATTTATAATAAGGGTAAAAATACTTTGGTGTGATTAAGGGACGACAAGACCCTA AAAGCTTTATTTTTAATATGAGTTTGAGTTTAAAATAAAACAGAAAGTTTAACTGGGGTAGTTTTTTTG TAAAATCTGAGGTTGTAAAAGGCATATAAAATGGAGTTAGGTTCTTTAGATAAGGATAATTTGAGTGAG TTACTTTAGGGATAACAGCGTAATAGTCCTAGGGAGATCGTATCTATGGGATTGATTGCGACCTCGATG TTGAATTAAAAGCTCAGTGTAGAGCAGAAGCTACGGGGTGAGGGTTTGTTCAACCTTTAAATTTTTA Type locality. Southwestern Atlantic, off Brazil, Brazil Basin, 26°33'21"S 035°11'29"W, 4480 m. Etymology. Sigmiferus , - a , - um , adjective created in combining Sigma , which is the eighteenth letter of the Greek alphabet, and the suffix - ferus , which means bearing. The name alludes to the dorsal sigmoid profile of most segments of the pereon and pleosome of the species. Description. Holotype, 53 mm, presumed female. Body : pereonites 2–7 and pleosomites 1–3 posteriorly carinate; the most carinate body segment, i.e. pereonites 6–7 and pleosomites 1–3 have a sigmoid profile: they present a slight anterior concavity (which is deeper in pleosomite 3). Head : anterior lobe of head strongly produced; ventral corner of eye blunt and pointing obliquely backwards. Mandible : article 2 of palp posteriorly not expanded and distally not tapering. Maxilliped : Inner plate with 9–10 ... |
|---|