Lehetua indrekii Tedersoo 2024, sp. nov. ...
Lehetua indrekii Tedersoo sp. nov. Diagnosis. Separation from other species of Lehetua based on the ITS region (positions 219–248 ttataatcttacgaagtactgaggtgatta; one mismatch allowed) and LSU (positions 515–546 aactaaaggratgtggctcctcggagtgttta; one mismatch allowed) as indicated in Fig. 9. Type. Soi...
Main Authors: | , , , |
---|---|
Format: | Text |
Language: | unknown |
Published: |
Zenodo
2024
|
Subjects: | |
Online Access: | https://dx.doi.org/10.5281/zenodo.13286521 https://zenodo.org/doi/10.5281/zenodo.13286521 |
id |
ftdatacite:10.5281/zenodo.13286521 |
---|---|
record_format |
openpolar |
spelling |
ftdatacite:10.5281/zenodo.13286521 2024-09-15T18:38:01+00:00 Lehetua indrekii Tedersoo 2024, sp. nov. ... Tedersoo, Leho Magurno, Franco Alkahtani, Saad Mikryukov, Vladimir 2024 https://dx.doi.org/10.5281/zenodo.13286521 https://zenodo.org/doi/10.5281/zenodo.13286521 unknown Zenodo http://publication.plazi.org/id/3EA0E723E6FC58B08491ED4CC2FBAB87 https://sibils.text-analytics.ch/search/collections/plazi/EB330B0EF11F5A3CAA197758D63BE4E1 https://www.gbif.org/species/238039815 https://www.checklistbank.org/dataset/301170/taxon/EB330B0EF11F5A3CAA197758D63BE4E1.taxon https://binary.pensoft.net/fig/1111396 https://dx.doi.org/10.3897/mycokeys.107.125549 http://publication.plazi.org/id/3EA0E723E6FC58B08491ED4CC2FBAB87 https://sibils.text-analytics.ch/search/collections/plazi/EB330B0EF11F5A3CAA197758D63BE4E1 https://www.gbif.org/species/238039815 https://www.checklistbank.org/dataset/301170/taxon/EB330B0EF11F5A3CAA197758D63BE4E1.taxon https://dx.doi.org/10.3897/mycokeys.107.125549.figure9 https://binary.pensoft.net/fig/1111396 https://dx.doi.org/10.5281/zenodo.13286522 Creative Commons Zero v1.0 Universal https://creativecommons.org/publicdomain/zero/1.0/legalcode cc0-1.0 Biodiversity Taxonomy Fungi Tracheophyta Magnoliopsida Lehetuales Lehetuaceae Lehetua Lehetua indrekii Text Taxonomic treatment ScholarlyArticle article-journal 2024 ftdatacite https://doi.org/10.5281/zenodo.1328652110.3897/mycokeys.107.12554910.3897/mycokeys.107.125549.figure910.5281/zenodo.13286522 2024-09-02T08:12:19Z Lehetua indrekii Tedersoo sp. nov. Diagnosis. Separation from other species of Lehetua based on the ITS region (positions 219–248 ttataatcttacgaagtactgaggtgatta; one mismatch allowed) and LSU (positions 515–546 aactaaaggratgtggctcctcggagtgttta; one mismatch allowed) as indicated in Fig. 9. Type. Soil eDNA sample TUE 103095 (holotype); type sequence EUK 1603180 (lectotype); GSMc plot S 590, Populus tremula forest (soil sample TUE 003095) in Lehetu, Estonia, 59.01857 ° N, 24.28041 ° E. Description. Other sequences: EUK 1603180 (type locality); EUK 1602367 (LSU only; type locality; also found in 50 other sites in Estonia); EUK 1634481 (GSMc plot G 4195, Quercus robur woodland soil in Lustivere, Estonia, 58.66293 ° N, 26.08465 ° E); EUK 1603818 (GSMc plot G 5824, managed grassland soil in Kuremaa, Estonia, 58.74138 ° N, 26.52727 ° E); EUK 1603131 (GSMc plot G 4105, Picea abies forest soil in Lepa, Estonia, 57.70158 ° N, 26.23993 ° E); EUK 0021956 (GSMc plot G 5150, subarctic grassland soil in Kokelv, Norway, ... : Published as part of Tedersoo, Leho, Magurno, Franco, Alkahtani, Saad & Mikryukov, Vladimir, 2024, Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes), pp. 249-271 in MycoKeys 107 on pages 249-271, DOI: 10.3897/mycokeys.107.125549 ... Text Subarctic DataCite |
institution |
Open Polar |
collection |
DataCite |
op_collection_id |
ftdatacite |
language |
unknown |
topic |
Biodiversity Taxonomy Fungi Tracheophyta Magnoliopsida Lehetuales Lehetuaceae Lehetua Lehetua indrekii |
spellingShingle |
Biodiversity Taxonomy Fungi Tracheophyta Magnoliopsida Lehetuales Lehetuaceae Lehetua Lehetua indrekii Tedersoo, Leho Magurno, Franco Alkahtani, Saad Mikryukov, Vladimir Lehetua indrekii Tedersoo 2024, sp. nov. ... |
topic_facet |
Biodiversity Taxonomy Fungi Tracheophyta Magnoliopsida Lehetuales Lehetuaceae Lehetua Lehetua indrekii |
description |
Lehetua indrekii Tedersoo sp. nov. Diagnosis. Separation from other species of Lehetua based on the ITS region (positions 219–248 ttataatcttacgaagtactgaggtgatta; one mismatch allowed) and LSU (positions 515–546 aactaaaggratgtggctcctcggagtgttta; one mismatch allowed) as indicated in Fig. 9. Type. Soil eDNA sample TUE 103095 (holotype); type sequence EUK 1603180 (lectotype); GSMc plot S 590, Populus tremula forest (soil sample TUE 003095) in Lehetu, Estonia, 59.01857 ° N, 24.28041 ° E. Description. Other sequences: EUK 1603180 (type locality); EUK 1602367 (LSU only; type locality; also found in 50 other sites in Estonia); EUK 1634481 (GSMc plot G 4195, Quercus robur woodland soil in Lustivere, Estonia, 58.66293 ° N, 26.08465 ° E); EUK 1603818 (GSMc plot G 5824, managed grassland soil in Kuremaa, Estonia, 58.74138 ° N, 26.52727 ° E); EUK 1603131 (GSMc plot G 4105, Picea abies forest soil in Lepa, Estonia, 57.70158 ° N, 26.23993 ° E); EUK 0021956 (GSMc plot G 5150, subarctic grassland soil in Kokelv, Norway, ... : Published as part of Tedersoo, Leho, Magurno, Franco, Alkahtani, Saad & Mikryukov, Vladimir, 2024, Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes), pp. 249-271 in MycoKeys 107 on pages 249-271, DOI: 10.3897/mycokeys.107.125549 ... |
format |
Text |
author |
Tedersoo, Leho Magurno, Franco Alkahtani, Saad Mikryukov, Vladimir |
author_facet |
Tedersoo, Leho Magurno, Franco Alkahtani, Saad Mikryukov, Vladimir |
author_sort |
Tedersoo, Leho |
title |
Lehetua indrekii Tedersoo 2024, sp. nov. ... |
title_short |
Lehetua indrekii Tedersoo 2024, sp. nov. ... |
title_full |
Lehetua indrekii Tedersoo 2024, sp. nov. ... |
title_fullStr |
Lehetua indrekii Tedersoo 2024, sp. nov. ... |
title_full_unstemmed |
Lehetua indrekii Tedersoo 2024, sp. nov. ... |
title_sort |
lehetua indrekii tedersoo 2024, sp. nov. ... |
publisher |
Zenodo |
publishDate |
2024 |
url |
https://dx.doi.org/10.5281/zenodo.13286521 https://zenodo.org/doi/10.5281/zenodo.13286521 |
genre |
Subarctic |
genre_facet |
Subarctic |
op_relation |
http://publication.plazi.org/id/3EA0E723E6FC58B08491ED4CC2FBAB87 https://sibils.text-analytics.ch/search/collections/plazi/EB330B0EF11F5A3CAA197758D63BE4E1 https://www.gbif.org/species/238039815 https://www.checklistbank.org/dataset/301170/taxon/EB330B0EF11F5A3CAA197758D63BE4E1.taxon https://binary.pensoft.net/fig/1111396 https://dx.doi.org/10.3897/mycokeys.107.125549 http://publication.plazi.org/id/3EA0E723E6FC58B08491ED4CC2FBAB87 https://sibils.text-analytics.ch/search/collections/plazi/EB330B0EF11F5A3CAA197758D63BE4E1 https://www.gbif.org/species/238039815 https://www.checklistbank.org/dataset/301170/taxon/EB330B0EF11F5A3CAA197758D63BE4E1.taxon https://dx.doi.org/10.3897/mycokeys.107.125549.figure9 https://binary.pensoft.net/fig/1111396 https://dx.doi.org/10.5281/zenodo.13286522 |
op_rights |
Creative Commons Zero v1.0 Universal https://creativecommons.org/publicdomain/zero/1.0/legalcode cc0-1.0 |
op_doi |
https://doi.org/10.5281/zenodo.1328652110.3897/mycokeys.107.12554910.3897/mycokeys.107.125549.figure910.5281/zenodo.13286522 |
_version_ |
1810482353472012288 |