Diatom sedimentary ancient DNA metabarcoding from western Fram Strait and Kronotsky Peninsula ...

• Main Authors: Zimmermann, Heike, Stoof-Leichsenring, Kathleen R., Kruse, Stefan, Müller, Juliane, Stein, Ruediger, Tiedemann, Ralf, Herzschuh, Ulrike
• Format: Dataset
• Language: English
• Published: Dryad 2020
• Subjects: Fram Strait; Kamchatka; North Atlantic; Subarctic
• Online Access: https://dx.doi.org/10.5061/dryad.bnzs7h481; https://datadryad.org/stash/dataset/doi:10.5061/dryad.bnzs7h481

In this study we use sedimentary ancient DNA metabarcoding from two marine sediment cores. The first Kastenlot core MSM05/5-712-2 was taken at western Fram Strait (subarctic North Atlantic) from which we collected 12 samples including one biological replicate. The second Kastenlot core SO201-2-12KL was retrieved from Kamchatka Strait (subarctic North Pacific) from which we collected 9 samples and 2 samples were collected from a pilot core taken next to the Kastenlot core. Total DNA was extracted from approximately 2ml sediment per sample in 3 batches with up to 9 samples and one extraction blank. Total DNA was concentrated and if necessary diluted to 2.5 ng/µl. For each batch we performed PCRs in triplicates including a PCR no template control (NTC). We amplified a diatom-specific, 76 bp long part of the rbcL gene with tagged primers Diat_rbcL_705F (AACAGGTGAAGTTAAAGGTTCATAYTT) and Diat_rbcL_808R (TGTAACCCATAACTAAATCGATCAT). The PCR-products were purified and pooled in equal concentrations. The sequencing ... : Here, we provide the raw paired-end sequencing data received from Fasteris as gz-compressed fastq files (frorward reads: 190128_NB501850_A_L1-4_AGAK-6_R1.fastq.gz; reverse reads: 190128_NB501850_A_L1-4_AGAK-6_R2.fastq.gz). Data processing, which includes assignment of the sequencing reads to the different samples with a tagfile (tagfile_AGAK-6.txt), denoising and taxonomic assignment of reads, was performed with the OBITools pipeline (https://pythonhosted.org/OBITools/welcome.html). The script containing the commands used to process the data is provided (AGAK-6.log). Taxonomic assignment based on (diat_embl138_final.fasta). Finally, we provide the resulting table which was annotated with the age and depth information per sample (AGAK-6_rbcL_embl138.txt). ...