Data from: Long-term dynamics in microbial eukaryotes communities: a paleolimnological view based on sedimentary DNA ...
Assessing the extent to which changes in lacustrine biodiversity are affected by anthropogenic or climatic forces requires extensive palaeolimnological data. We used high-throughput sequencing to generate time-series data encompassing over 2200 years of microbial eukaryotes (protists and Fungi) dive...
Main Authors: | , , , , , , , , , , , |
---|---|
Format: | Dataset |
Language: | English |
Published: |
Dryad
2016
|
Subjects: | |
Online Access: | https://dx.doi.org/10.5061/dryad.6vd87 https://datadryad.org/stash/dataset/doi:10.5061/dryad.6vd87 |
id |
ftdatacite:10.5061/dryad.6vd87 |
---|---|
record_format |
openpolar |
spelling |
ftdatacite:10.5061/dryad.6vd87 2024-02-04T10:00:55+01:00 Data from: Long-term dynamics in microbial eukaryotes communities: a paleolimnological view based on sedimentary DNA ... Capo, Eric Debroas, Didier Arnaud, Fabien Guillemot, Typhaine Bichet, Vincent Millet, Laurent Gauthier, Emilie Massa, Charly Develle, Anne-Lise Pignol, Cecile Lejzerowicz, Franck Domaizon, Isabelle 2016 https://dx.doi.org/10.5061/dryad.6vd87 https://datadryad.org/stash/dataset/doi:10.5061/dryad.6vd87 en eng Dryad https://dx.doi.org/10.1111/mec.13893 Creative Commons Zero v1.0 Universal https://creativecommons.org/publicdomain/zero/1.0/legalcode cc0-1.0 Protists Lake Dataset dataset 2016 ftdatacite https://doi.org/10.5061/dryad.6vd8710.1111/mec.13893 2024-01-05T01:14:15Z Assessing the extent to which changes in lacustrine biodiversity are affected by anthropogenic or climatic forces requires extensive palaeolimnological data. We used high-throughput sequencing to generate time-series data encompassing over 2200 years of microbial eukaryotes (protists and Fungi) diversity changes from the sedimentary DNA record of two lakes (Lake Bourget in French Alps and Lake Igaliku in Greenland). From 176 samples, we sequenced a large diversity of microbial eukaryotes, with a total 16 386 operational taxonomic units distributed within 50 phylogenetic groups. Thus, microbial groups, such as Chlorophyta, Dinophyceae, Haptophyceae and Ciliophora, that were not previously considered in lacustrine sediment record analyses appeared to be potential biological markers of trophic status changes. Our data suggest that shifts in relative abundance of extant species, including shifts between rare and abundant taxa, drive ecosystem responses to local and global environmental changes. Community ... : seqAll_mixEUKDemultiplexing file from MiSEQ sequencing (2 x 250 bp) of a Mock community (16 species) amplifiying with the following primers: 960F: GGCTTAATTTGACTCAACRCG 1419R: GGGCATCACAGACCTGTTAT For obtaining this file, the paired-end reads were merged together using UPARSE tools (option -fastq_mergepairs with a minimal overlap equal to 150 and no mismatch allowed) (Edgar, 2013). and the merged sequences were then submitted to the following cleaning procedures: (i) no undefined bases (Ns), (ii) a minimum sequence length of 200 bp, and (iii) no sequencing error in the forward and reverse primers. Composition of the mock community: A50 Eukaryota;Rhizaria;Cercozoa; A31 Eukaryota;Alveolata;Perkinsea; A54 Eukaryota;Cryptophyceae A34 Eukaryota;Stramenopiles;Chrysophyceae; A44 Eukaryota;Fungi; PG5-14 Eukaryota;Archaeplastida;Chloroplastida;Chlorophyta;Chlorophyceae PG5-26 Eukaryota;Alveolata;Ciliophora; PG5-28 Eukaryota;Fungi;Cryptomycota; BI109 Eukaryota;Fungi;Cryptomycota; (LKM11 clade) B24 ... Dataset Greenland Igaliku DataCite Metadata Store (German National Library of Science and Technology) Greenland Igaliku ENVELOPE(-45.421,-45.421,60.988,60.988) |
institution |
Open Polar |
collection |
DataCite Metadata Store (German National Library of Science and Technology) |
op_collection_id |
ftdatacite |
language |
English |
topic |
Protists Lake |
spellingShingle |
Protists Lake Capo, Eric Debroas, Didier Arnaud, Fabien Guillemot, Typhaine Bichet, Vincent Millet, Laurent Gauthier, Emilie Massa, Charly Develle, Anne-Lise Pignol, Cecile Lejzerowicz, Franck Domaizon, Isabelle Data from: Long-term dynamics in microbial eukaryotes communities: a paleolimnological view based on sedimentary DNA ... |
topic_facet |
Protists Lake |
description |
Assessing the extent to which changes in lacustrine biodiversity are affected by anthropogenic or climatic forces requires extensive palaeolimnological data. We used high-throughput sequencing to generate time-series data encompassing over 2200 years of microbial eukaryotes (protists and Fungi) diversity changes from the sedimentary DNA record of two lakes (Lake Bourget in French Alps and Lake Igaliku in Greenland). From 176 samples, we sequenced a large diversity of microbial eukaryotes, with a total 16 386 operational taxonomic units distributed within 50 phylogenetic groups. Thus, microbial groups, such as Chlorophyta, Dinophyceae, Haptophyceae and Ciliophora, that were not previously considered in lacustrine sediment record analyses appeared to be potential biological markers of trophic status changes. Our data suggest that shifts in relative abundance of extant species, including shifts between rare and abundant taxa, drive ecosystem responses to local and global environmental changes. Community ... : seqAll_mixEUKDemultiplexing file from MiSEQ sequencing (2 x 250 bp) of a Mock community (16 species) amplifiying with the following primers: 960F: GGCTTAATTTGACTCAACRCG 1419R: GGGCATCACAGACCTGTTAT For obtaining this file, the paired-end reads were merged together using UPARSE tools (option -fastq_mergepairs with a minimal overlap equal to 150 and no mismatch allowed) (Edgar, 2013). and the merged sequences were then submitted to the following cleaning procedures: (i) no undefined bases (Ns), (ii) a minimum sequence length of 200 bp, and (iii) no sequencing error in the forward and reverse primers. Composition of the mock community: A50 Eukaryota;Rhizaria;Cercozoa; A31 Eukaryota;Alveolata;Perkinsea; A54 Eukaryota;Cryptophyceae A34 Eukaryota;Stramenopiles;Chrysophyceae; A44 Eukaryota;Fungi; PG5-14 Eukaryota;Archaeplastida;Chloroplastida;Chlorophyta;Chlorophyceae PG5-26 Eukaryota;Alveolata;Ciliophora; PG5-28 Eukaryota;Fungi;Cryptomycota; BI109 Eukaryota;Fungi;Cryptomycota; (LKM11 clade) B24 ... |
format |
Dataset |
author |
Capo, Eric Debroas, Didier Arnaud, Fabien Guillemot, Typhaine Bichet, Vincent Millet, Laurent Gauthier, Emilie Massa, Charly Develle, Anne-Lise Pignol, Cecile Lejzerowicz, Franck Domaizon, Isabelle |
author_facet |
Capo, Eric Debroas, Didier Arnaud, Fabien Guillemot, Typhaine Bichet, Vincent Millet, Laurent Gauthier, Emilie Massa, Charly Develle, Anne-Lise Pignol, Cecile Lejzerowicz, Franck Domaizon, Isabelle |
author_sort |
Capo, Eric |
title |
Data from: Long-term dynamics in microbial eukaryotes communities: a paleolimnological view based on sedimentary DNA ... |
title_short |
Data from: Long-term dynamics in microbial eukaryotes communities: a paleolimnological view based on sedimentary DNA ... |
title_full |
Data from: Long-term dynamics in microbial eukaryotes communities: a paleolimnological view based on sedimentary DNA ... |
title_fullStr |
Data from: Long-term dynamics in microbial eukaryotes communities: a paleolimnological view based on sedimentary DNA ... |
title_full_unstemmed |
Data from: Long-term dynamics in microbial eukaryotes communities: a paleolimnological view based on sedimentary DNA ... |
title_sort |
data from: long-term dynamics in microbial eukaryotes communities: a paleolimnological view based on sedimentary dna ... |
publisher |
Dryad |
publishDate |
2016 |
url |
https://dx.doi.org/10.5061/dryad.6vd87 https://datadryad.org/stash/dataset/doi:10.5061/dryad.6vd87 |
long_lat |
ENVELOPE(-45.421,-45.421,60.988,60.988) |
geographic |
Greenland Igaliku |
geographic_facet |
Greenland Igaliku |
genre |
Greenland Igaliku |
genre_facet |
Greenland Igaliku |
op_relation |
https://dx.doi.org/10.1111/mec.13893 |
op_rights |
Creative Commons Zero v1.0 Universal https://creativecommons.org/publicdomain/zero/1.0/legalcode cc0-1.0 |
op_doi |
https://doi.org/10.5061/dryad.6vd8710.1111/mec.13893 |
_version_ |
1789966432730087424 |