Supplemental Data Genetic Structure and Extinction of the Woolly Mammoth
Three different PCR-amplification strategies were employed to generate the 741 bp contig used in this analysis, as discussed in the Experimental Procedures. Strategy 1 climate of the Eastern-Siberian Arctic, derived from fossil plants, insects and animals. Quat. Sci. Rev. 24, 533–569. S7. Guthrie, R...
| Main Authors: | , , , , |
|---|---|
| Other Authors: | |
| Format: | Text |
| Language: | English |
| Subjects: | |
| Online Access: | http://citeseerx.ist.psu.edu/viewdoc/summary?doi=10.1.1.330.9453 http://download.cell.com/current-biology/mmcs/journals/0960-9822/piis0960982207014145.mmc1.pdf |
| id |
ftciteseerx:oai:CiteSeerX.psu:10.1.1.330.9453 |
|---|---|
| record_format |
openpolar |
| spelling |
ftciteseerx:oai:CiteSeerX.psu:10.1.1.330.9453 2023-05-15T14:57:01+02:00 Supplemental Data Genetic Structure and Extinction of the Woolly Mammoth Mammuthus Primigenius Tatiana Kuznetsova Andrei Sher Dale Guthrie Mark G. Thomas The Pennsylvania State University CiteSeerX Archives application/pdf http://citeseerx.ist.psu.edu/viewdoc/summary?doi=10.1.1.330.9453 http://download.cell.com/current-biology/mmcs/journals/0960-9822/piis0960982207014145.mmc1.pdf en eng http://citeseerx.ist.psu.edu/viewdoc/summary?doi=10.1.1.330.9453 http://download.cell.com/current-biology/mmcs/journals/0960-9822/piis0960982207014145.mmc1.pdf Metadata may be used without restrictions as long as the oai identifier remains attached to it. http://download.cell.com/current-biology/mmcs/journals/0960-9822/piis0960982207014145.mmc1.pdf text ftciteseerx 2016-09-04T00:41:24Z Three different PCR-amplification strategies were employed to generate the 741 bp contig used in this analysis, as discussed in the Experimental Procedures. Strategy 1 climate of the Eastern-Siberian Arctic, derived from fossil plants, insects and animals. Quat. Sci. Rev. 24, 533–569. S7. Guthrie, R.D. (2004). Radiocarbon evidence of mid-Holocene mammoths stranded on an Alaskan Bering Sea island. Nature 249, 746–749. mam_15038F GGCGTCCTAGCCCTACTCCTATCAAT mam_15399R TTGTTTGCAGGGAATAGTTTAAGAAG mam_15178F TGAATTGGCAGCCAACCAGTAGAA mam_15530R TATAAGCATGGGGTAAATAATGTGATG mam_15393F CCTCGCTATCAATACCCAAAACTG mam_15780R CGAGAAGAGGGACACGAAGATG Text Arctic Bering Sea Unknown Arctic Bering Sea |
| institution |
Open Polar |
| collection |
Unknown |
| op_collection_id |
ftciteseerx |
| language |
English |
| description |
Three different PCR-amplification strategies were employed to generate the 741 bp contig used in this analysis, as discussed in the Experimental Procedures. Strategy 1 climate of the Eastern-Siberian Arctic, derived from fossil plants, insects and animals. Quat. Sci. Rev. 24, 533–569. S7. Guthrie, R.D. (2004). Radiocarbon evidence of mid-Holocene mammoths stranded on an Alaskan Bering Sea island. Nature 249, 746–749. mam_15038F GGCGTCCTAGCCCTACTCCTATCAAT mam_15399R TTGTTTGCAGGGAATAGTTTAAGAAG mam_15178F TGAATTGGCAGCCAACCAGTAGAA mam_15530R TATAAGCATGGGGTAAATAATGTGATG mam_15393F CCTCGCTATCAATACCCAAAACTG mam_15780R CGAGAAGAGGGACACGAAGATG |
| author2 |
The Pennsylvania State University CiteSeerX Archives |
| format |
Text |
| author |
Mammuthus Primigenius Tatiana Kuznetsova Andrei Sher Dale Guthrie Mark G. Thomas |
| spellingShingle |
Mammuthus Primigenius Tatiana Kuznetsova Andrei Sher Dale Guthrie Mark G. Thomas Supplemental Data Genetic Structure and Extinction of the Woolly Mammoth |
| author_facet |
Mammuthus Primigenius Tatiana Kuznetsova Andrei Sher Dale Guthrie Mark G. Thomas |
| author_sort |
Mammuthus Primigenius |
| title |
Supplemental Data Genetic Structure and Extinction of the Woolly Mammoth |
| title_short |
Supplemental Data Genetic Structure and Extinction of the Woolly Mammoth |
| title_full |
Supplemental Data Genetic Structure and Extinction of the Woolly Mammoth |
| title_fullStr |
Supplemental Data Genetic Structure and Extinction of the Woolly Mammoth |
| title_full_unstemmed |
Supplemental Data Genetic Structure and Extinction of the Woolly Mammoth |
| title_sort |
supplemental data genetic structure and extinction of the woolly mammoth |
| url |
http://citeseerx.ist.psu.edu/viewdoc/summary?doi=10.1.1.330.9453 http://download.cell.com/current-biology/mmcs/journals/0960-9822/piis0960982207014145.mmc1.pdf |
| geographic |
Arctic Bering Sea |
| geographic_facet |
Arctic Bering Sea |
| genre |
Arctic Bering Sea |
| genre_facet |
Arctic Bering Sea |
| op_source |
http://download.cell.com/current-biology/mmcs/journals/0960-9822/piis0960982207014145.mmc1.pdf |
| op_relation |
http://citeseerx.ist.psu.edu/viewdoc/summary?doi=10.1.1.330.9453 http://download.cell.com/current-biology/mmcs/journals/0960-9822/piis0960982207014145.mmc1.pdf |
| op_rights |
Metadata may be used without restrictions as long as the oai identifier remains attached to it. |
| _version_ |
1766329088778174464 |