Transcriptomic analysis of the genes for lactate dehydrogenase isomers in the reindeer' rumen of the Nenets Autonomous District in summer

• Published in: The FASEB Journal
• Main Authors: Ilina, Larisa A., Filippova, Valentina A., Yildirim, Elena A., Dubrovin, Andrey V., Ponomareva, Ekaterina S., Laptev, Georgiy Y., Layshev, Kasim A.
• Other Authors: Russian Science Foundation
• Format: Article in Journal/Newspaper
• Language: English
• Published: Wiley 2022
• Subjects: Arctic; nenets
• Online Access: http://dx.doi.org/10.1096/fasebj.2022.36.s1.r2929

Reindeer are unique arctic ruminants. They exist in conditions of extremely poor nutrition; therefore, the processes occurring in the rumen are of great scientific interest. It is known that the formation of lactate in the rumen is a key mechanism of metabolic disorders in the body of ruminants. Therefore, the aim of our study was to study the difference in the expression of two isomers of lactate dehydrogenases in the rumen of reindeer and to assess the level of enzymes depending on the sex and age of the animals. To assess the differences in the formation of lactate by microorganisms of the rumen community of reindeer in the summer‐autumn period, we carried out a transcriptomic analysis of the D and L genes of lactate dehydrogenases. For this, 12 samples were taken to isolate RNA from females (vazhenki), males (choirs), and calves of rumen fluid from deer in the summer‐autumn period in the Nenets Autonomous District. Relative expression was calculated using the 2 ‐∆∆Ct method. The 16SrRNA gene was chosen as a reference gene. Primers for L‐lactate dehydrogenase: F: CATCAAAAAGTTGTGTTAGTCGGCG, R: TCAGCTAAACCGTCGTTAAGCACTT. Primers for D‐lactate dehydrogenase: F: CTGGGATCCGTTGAGGGAGATGCTTAAG, R: CCGAAGCTTTTAGTTGACCCGGTTGAC. As a result of our work, we identified differences in the expression of lactate dehydrogenase genes between male and female reindeer. In males, a lower level of expression of genes of lactate dehydrogenases L and D types in the rumen was noted in comparison with females. It was 10 times less than that in the female rumen (p = 0.002 for L‐ldh, p = 0.001 for D‐ldh). Calves also showed higher levels of expression of these two genes compared to adult animals. The expression level of L‐ldh in the rumen of calves was 3 times higher than in adult animals (p = 0.03), and D‐ldh was two times less than in adult animals (p = 0.04). Lactic acid is formed as a result of lactic acid fermentation under the action of two different forms of lactate dehydrogenases: one of them (EC 1.1.1.27) produces the isomer L ...